Transcript: Mouse XM_017320017.1

PREDICTED: Mus musculus matrix metallopeptidase 16 (Mmp16), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mmp16 (17389)
Length:
9956
CDS:
615..2438

Additional Resources:

NCBI RefSeq record:
XM_017320017.1
NBCI Gene record:
Mmp16 (17389)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017320017.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434551 CTGTACTGTAAACGCTCTATG pLKO_005 2403 CDS 100% 10.800 15.120 N MMP16 n/a
2 TRCN0000032834 CGCCACATACTGTACTGTAAA pLKO.1 2394 CDS 100% 13.200 10.560 N Mmp16 n/a
3 TRCN0000433534 ATGGATACCCAATGCAAATTA pLKO_005 1738 CDS 100% 15.000 10.500 N MMP16 n/a
4 TRCN0000032835 CCCAGTATTGATGCAGTTTAT pLKO.1 1782 CDS 100% 13.200 9.240 N Mmp16 n/a
5 TRCN0000032837 GCAGCAGTTCTATGGCATTAA pLKO.1 842 CDS 100% 13.200 9.240 N Mmp16 n/a
6 TRCN0000052252 GCAGTTCTATGGCATTAACAT pLKO.1 845 CDS 100% 5.625 3.938 N MMP16 n/a
7 TRCN0000032838 CCACCAGATGATGTAGACATT pLKO.1 2247 CDS 100% 4.950 3.465 N Mmp16 n/a
8 TRCN0000052251 CCCACCAGATGATGTAGACAT pLKO.1 2246 CDS 100% 4.950 2.970 N MMP16 n/a
9 TRCN0000032836 GCCTTTGATGTGTGGCAGAAT pLKO.1 1077 CDS 100% 4.950 2.970 N Mmp16 n/a
10 TRCN0000052250 CGTGATGTGGATATAACCATT pLKO.1 1152 CDS 100% 4.950 3.960 N MMP16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017320017.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.