Transcript: Mouse XM_017320118.1

PREDICTED: Mus musculus unc-13 homolog B (C. elegans) (Unc13b), transcript variant X11, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Unc13b (22249)
Length:
6054
CDS:
655..5211

Additional Resources:

NCBI RefSeq record:
XM_017320118.1
NBCI Gene record:
Unc13b (22249)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017320118.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257040 AGACCGCATCATCGCCATTTA pLKO_005 1463 CDS 100% 13.200 10.560 N Unc13b n/a
2 TRCN0000244619 CAACTCTTCTGATCGAATTAA pLKO_005 2349 CDS 100% 15.000 10.500 N Unc13b n/a
3 TRCN0000244620 GCCAACATCAATGCCTATTAT pLKO_005 2857 CDS 100% 15.000 10.500 N Unc13b n/a
4 TRCN0000244621 GAAGATCCGAGAACGGAATAA pLKO_005 2046 CDS 100% 13.200 9.240 N Unc13b n/a
5 TRCN0000244618 TTAGAGTCCTTGTAGTCAAAT pLKO_005 5297 3UTR 100% 13.200 9.240 N Unc13b n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 5957 3UTR 100% 4.950 2.475 Y KAAG1 n/a
7 TRCN0000002356 CTCTCTACATACAGGAATAAT pLKO.1 2995 CDS 100% 15.000 12.000 N UNC13B n/a
8 TRCN0000320384 CTCTCTACATACAGGAATAAT pLKO_005 2995 CDS 100% 15.000 12.000 N UNC13B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017320118.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.