Transcript: Mouse XM_017320207.1

PREDICTED: Mus musculus basonuclin 2 (Bnc2), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Bnc2 (242509)
Length:
13958
CDS:
1553..4975

Additional Resources:

NCBI RefSeq record:
XM_017320207.1
NBCI Gene record:
Bnc2 (242509)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017320207.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108175 GCCGAATGTTATTAGAATCAA pLKO.1 6127 3UTR 100% 5.625 7.875 N BNC2 n/a
2 TRCN0000095492 CTAAGGAATAACCGAGACAAA pLKO.1 3113 CDS 100% 4.950 6.930 N Bnc2 n/a
3 TRCN0000108178 CGTAAACTGTTGACCAAAGAA pLKO.1 4340 CDS 100% 5.625 4.500 N BNC2 n/a
4 TRCN0000327841 CGTAAACTGTTGACCAAAGAA pLKO_005 4340 CDS 100% 5.625 4.500 N BNC2 n/a
5 TRCN0000095490 CCGAGCATTTCAACTCAGAAT pLKO.1 2672 CDS 100% 4.950 3.960 N Bnc2 n/a
6 TRCN0000095491 CGCTGACACTAACCTCTTATT pLKO.1 1903 CDS 100% 13.200 9.240 N Bnc2 n/a
7 TRCN0000095489 GCATGGCAGATTCACCTGTAA pLKO.1 5485 3UTR 100% 4.950 3.465 N Bnc2 n/a
8 TRCN0000095493 GCTAAGGAATAACCGAGACAA pLKO.1 3112 CDS 100% 4.950 3.465 N Bnc2 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 5254 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017320207.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.