Transcript: Mouse XM_017320261.1

PREDICTED: Mus musculus myb-like, SWIRM and MPN domains 1 (Mysm1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mysm1 (320713)
Length:
2347
CDS:
48..2243

Additional Resources:

NCBI RefSeq record:
XM_017320261.1
NBCI Gene record:
Mysm1 (320713)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017320261.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085875 CCACCAATCAAGGAGAATTAT pLKO.1 802 CDS 100% 15.000 10.500 N Mysm1 n/a
2 TRCN0000422350 GAACAAGGACTGGCTAAATTT pLKO_005 426 CDS 100% 15.000 10.500 N Mysm1 n/a
3 TRCN0000414331 GATGTGAGCAGGCAGTATATA pLKO_005 1405 CDS 100% 15.000 10.500 N Mysm1 n/a
4 TRCN0000415447 GAAATATGCAAACCGAAATAC pLKO_005 1281 CDS 100% 13.200 9.240 N Mysm1 n/a
5 TRCN0000429829 CAAGAAGGTCCATTAGCTAAA pLKO_005 825 CDS 100% 10.800 7.560 N Mysm1 n/a
6 TRCN0000085873 GCTGTAAAGATTGAGAAGTTA pLKO.1 669 CDS 100% 5.625 3.938 N Mysm1 n/a
7 TRCN0000085874 GCAGCAGTGATCTTCAGGTTA pLKO.1 577 CDS 100% 4.950 3.465 N Mysm1 n/a
8 TRCN0000085877 CCTTGCCAAATTGAGGAGGAA pLKO.1 1095 CDS 100% 2.640 1.848 N Mysm1 n/a
9 TRCN0000085876 GAAATGATGAAAGTACAGCAT pLKO.1 109 CDS 100% 2.640 1.848 N Mysm1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017320261.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.