Transcript: Mouse XM_017320333.1

PREDICTED: Mus musculus serine/arginine-rich splicing factor 4 (Srsf4), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Srsf4 (57317)
Length:
3658
CDS:
1529..3019

Additional Resources:

NCBI RefSeq record:
XM_017320333.1
NBCI Gene record:
Srsf4 (57317)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017320333.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071587 GTGTCAAAGGAGCGCGAACAT pLKO.1 2765 CDS 100% 4.950 6.930 N Srsf4 n/a
2 TRCN0000327131 GTGTCAAAGGAGCGCGAACAT pLKO_005 2765 CDS 100% 4.950 6.930 N Srsf4 n/a
3 TRCN0000071583 CCGCAGTAAGAGTAAAGACCA pLKO.1 2341 CDS 100% 2.640 2.112 N Srsf4 n/a
4 TRCN0000327059 CCGCAGTAAGAGTAAAGACCA pLKO_005 2341 CDS 100% 2.640 2.112 N Srsf4 n/a
5 TRCN0000071584 GAACTGAAGTCAACGGCAGAA pLKO.1 2028 CDS 100% 4.050 2.835 N Srsf4 n/a
6 TRCN0000327061 GAACTGAAGTCAACGGCAGAA pLKO_005 2028 CDS 100% 4.050 2.835 N Srsf4 n/a
7 TRCN0000071586 CAGGTCAAGATCCACCTCCAA pLKO.1 2860 CDS 100% 2.640 1.848 N Srsf4 n/a
8 TRCN0000327060 CAGGTCAAGATCCACCTCCAA pLKO_005 2860 CDS 100% 2.640 1.848 N Srsf4 n/a
9 TRCN0000071585 CCCTGACAAGAGCCGCAGTAA pLKO.1 2329 CDS 100% 1.650 1.155 N Srsf4 n/a
10 TRCN0000327058 CCCTGACAAGAGCCGCAGTAA pLKO_005 2329 CDS 100% 1.650 1.155 N Srsf4 n/a
11 TRCN0000231449 GACGCAGTGGATATGGTTATA pLKO_005 1788 CDS 100% 13.200 9.240 N SRSF4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017320333.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.