Transcript: Mouse XM_017320346.1

PREDICTED: Mus musculus transmembrane protein 57 (Tmem57), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tmem57 (66146)
Length:
3519
CDS:
453..1916

Additional Resources:

NCBI RefSeq record:
XM_017320346.1
NBCI Gene record:
Tmem57 (66146)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017320346.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422894 TGATTCCATAGCTGCATTAAA pLKO_005 2352 3UTR 100% 15.000 21.000 N Tmem57 n/a
2 TRCN0000412925 ATAACATCCAAGTCTGATTAG pLKO_005 2048 3UTR 100% 10.800 15.120 N Tmem57 n/a
3 TRCN0000126372 CCAGAGATAGAATATCGAGAA pLKO.1 663 CDS 100% 4.050 5.670 N Tmem57 n/a
4 TRCN0000416420 AGATACAAGAGATTGAGTATA pLKO_005 766 CDS 100% 13.200 9.240 N Tmem57 n/a
5 TRCN0000418070 GGTATCTACGGCAGTACATTT pLKO_005 115 5UTR 100% 13.200 9.240 N Tmem57 n/a
6 TRCN0000126373 CCAGCTAGAGAAGAAGCTAAA pLKO.1 1283 CDS 100% 10.800 7.560 N Tmem57 n/a
7 TRCN0000126370 CCAGGAAATCAAGGACCTAAA pLKO.1 1733 CDS 100% 10.800 7.560 N Tmem57 n/a
8 TRCN0000416377 TTGTCCTCCTTGCCGACTTTG pLKO_005 167 5UTR 100% 10.800 7.560 N Tmem57 n/a
9 TRCN0000126369 CGTGCCATTTACTGCTTTCTT pLKO.1 2780 3UTR 100% 5.625 3.938 N Tmem57 n/a
10 TRCN0000126371 CGTCTATGATTCCTTCAGATA pLKO.1 240 5UTR 100% 4.950 3.465 N Tmem57 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017320346.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.