Transcript: Mouse XM_017320355.1

PREDICTED: Mus musculus ring finger protein 220 (Rnf220), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rnf220 (66743)
Length:
4397
CDS:
1857..3557

Additional Resources:

NCBI RefSeq record:
XM_017320355.1
NBCI Gene record:
Rnf220 (66743)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017320355.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000275376 GATCGGAATGACAGATGTAAG pLKO_005 2466 CDS 100% 10.800 8.640 N RNF220 n/a
2 TRCN0000039524 GCTCACTTAAGGTTGATGATA pLKO.1 2380 CDS 100% 5.625 4.500 N Rnf220 n/a
3 TRCN0000039527 GCCTCTATGTACCACCGGCAA pLKO.1 2064 CDS 100% 0.720 0.576 N Rnf220 n/a
4 TRCN0000375796 AGACTGAAGCACATGTAATAT pLKO_005 3864 3UTR 100% 15.000 10.500 N Rnf220 n/a
5 TRCN0000160783 CGGTGTTCAGTGGTGTATATT pLKO.1 4080 3UTR 100% 15.000 10.500 N RNF220 n/a
6 TRCN0000275285 CGGTGTTCAGTGGTGTATATT pLKO_005 4080 3UTR 100% 15.000 10.500 N RNF220 n/a
7 TRCN0000375798 CAGCGAGTTGCAGGAACATAT pLKO_005 2555 CDS 100% 13.200 9.240 N Rnf220 n/a
8 TRCN0000271882 GGAGTATGGGAAACCACAATA pLKO_005 3062 CDS 100% 13.200 9.240 N Rnf220 n/a
9 TRCN0000271925 TCGGTGTTCAGTGGTGTATAT pLKO_005 4079 3UTR 100% 13.200 9.240 N Rnf220 n/a
10 TRCN0000366980 ATACTGGGAAGAAGATCTTTG pLKO_005 2398 CDS 100% 10.800 7.560 N Rnf220 n/a
11 TRCN0000376835 CCTGCAAGAACAGCGACATTG pLKO_005 3277 CDS 100% 10.800 7.560 N Rnf220 n/a
12 TRCN0000039526 ACCTGCAAGAACAGCGACATT pLKO.1 3276 CDS 100% 4.950 3.465 N Rnf220 n/a
13 TRCN0000039528 CTCAGACAGATACCAGACCTT pLKO.1 2747 CDS 100% 2.640 1.848 N Rnf220 n/a
14 TRCN0000161359 GCAAGGAATATGACTTTGGGA pLKO.1 2335 CDS 100% 0.750 0.525 N RNF220 n/a
15 TRCN0000281842 ACCTGCGGAGGATCTACTTAT pLKO_005 3535 CDS 100% 13.200 7.920 N Rnf220 n/a
16 TRCN0000039525 GAGAGCTATCAGTCTGCCTTT pLKO.1 2244 CDS 100% 4.050 2.430 N Rnf220 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017320355.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.