Transcript: Mouse XM_017320437.1

PREDICTED: Mus musculus mindbomb E3 ubiquitin protein ligase 2 (Mib2), transcript variant X9, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mib2 (76580)
Length:
3708
CDS:
855..3347

Additional Resources:

NCBI RefSeq record:
XM_017320437.1
NBCI Gene record:
Mib2 (76580)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017320437.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000366043 GACGGCTCAGAGGTGGTAAAT pLKO_005 3395 3UTR 100% 13.200 10.560 N Mib2 n/a
2 TRCN0000041148 GCTCTATGACAACGCCCAAAT pLKO.1 1079 CDS 100% 10.800 8.640 N Mib2 n/a
3 TRCN0000374337 AGGGCACACGTACCAACTATC pLKO_005 1027 CDS 100% 10.800 7.560 N Mib2 n/a
4 TRCN0000366045 CTCTATGACAACGCCCAAATC pLKO_005 1080 CDS 100% 10.800 7.560 N Mib2 n/a
5 TRCN0000366044 TCGATGTCACTGCTACCAATA pLKO_005 2701 CDS 100% 10.800 7.560 N Mib2 n/a
6 TRCN0000041150 TCGAAGGATGAAGAAGTGTAT pLKO.1 3337 CDS 100% 4.950 3.465 N Mib2 n/a
7 TRCN0000374328 CTGATCGCAGACCTTCCTTCA pLKO_005 3655 3UTR 100% 4.050 2.835 N Mib2 n/a
8 TRCN0000041151 GTGGTGAAGGTGTTTGGAGAT pLKO.1 1953 CDS 100% 4.050 2.430 N Mib2 n/a
9 TRCN0000438514 GGACAAGGTCAAGTGTCTGCT pLKO_005 1634 CDS 100% 2.640 1.584 N MIB2 n/a
10 TRCN0000041149 GCGCTATGAGACATCTCACTT pLKO.1 1247 CDS 100% 4.950 6.930 N Mib2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017320437.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.