Transcript: Mouse XM_017320587.1

PREDICTED: Mus musculus A kinase (PRKA) anchor protein (yotiao) 9 (Akap9), transcript variant X8, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Akap9 (100986)
Length:
14029
CDS:
617..11878

Additional Resources:

NCBI RefSeq record:
XM_017320587.1
NBCI Gene record:
Akap9 (100986)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017320587.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000339626 AGTTGAGGAACAGACGTTAAA pLKO_005 5578 CDS 100% 13.200 18.480 N Akap9 n/a
2 TRCN0000362771 CAGCCGAACTGCGACAGATTT pLKO_005 1342 CDS 100% 13.200 18.480 N Akap9 n/a
3 TRCN0000088590 GCCGCATAGTAGAACTGTTAA pLKO.1 10179 CDS 100% 13.200 18.480 N Akap9 n/a
4 TRCN0000339628 AGAAGTAGAACATCGAATAAA pLKO_005 2485 CDS 100% 15.000 12.000 N Akap9 n/a
5 TRCN0000351098 GAATTTGAAGCCGCCATTAAA pLKO_005 1157 CDS 100% 15.000 10.500 N Akap9 n/a
6 TRCN0000351099 GCAAAGAGTTAGGCGAATATA pLKO_005 5052 CDS 100% 15.000 10.500 N Akap9 n/a
7 TRCN0000362703 CAAGAACTTGTGCGACAATAT pLKO_005 5273 CDS 100% 13.200 9.240 N Akap9 n/a
8 TRCN0000088589 GCCCAGAATTACAAGAGTATA pLKO.1 4218 CDS 100% 13.200 9.240 N Akap9 n/a
9 TRCN0000339627 GTTCATGCACAGTAATCATTA pLKO_005 13704 3UTR 100% 13.200 9.240 N Akap9 n/a
10 TRCN0000362770 ACCAATACATGCACAGCTTAT pLKO_005 13611 3UTR 100% 10.800 7.560 N Akap9 n/a
11 TRCN0000088588 GCAGCAGCACATGAAGACAAA pLKO.1 13651 3UTR 100% 4.950 2.970 N Akap9 n/a
12 TRCN0000166364 CACACACACACACACACACAA pLKO.1 13163 3UTR 100% 4.950 2.475 Y KAAG1 n/a
13 TRCN0000123989 GAGTCTTTGAAGAAAGAACTT pLKO.1 8699 CDS 100% 0.495 0.248 Y Sycp3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017320587.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.