Transcript: Mouse XM_017320619.1

PREDICTED: Mus musculus processing of precursor 5, ribonuclease P/MRP family (S. cerevisiae) (Pop5), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pop5 (117109)
Length:
1110
CDS:
419..889

Additional Resources:

NCBI RefSeq record:
XM_017320619.1
NBCI Gene record:
Pop5 (117109)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017320619.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241510 CCGATACCTCAATGCCTACAC pLKO_005 544 CDS 100% 4.050 5.670 N Pop5 n/a
2 TRCN0000241512 ACTTGTGGGAACAGGACATTA pLKO_005 904 3UTR 100% 13.200 9.240 N Pop5 n/a
3 TRCN0000241509 TCTTCCTTTCATCACCTATTT pLKO_005 619 CDS 100% 13.200 9.240 N Pop5 n/a
4 TRCN0000178738 CCACAGTTCTCCAATGGAAAT pLKO.1 945 3UTR 100% 10.800 7.560 N Pop5 n/a
5 TRCN0000241511 GAGAACAAAGGCCACCGTTAC pLKO_005 641 CDS 100% 6.000 4.200 N Pop5 n/a
6 TRCN0000245395 AGAAGTTCCTGATCCAGTACA pLKO_005 711 CDS 100% 4.950 3.465 N Pop5 n/a
7 TRCN0000183977 CCCACAGTTCTCCAATGGAAA pLKO.1 944 3UTR 100% 4.950 2.970 N Pop5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017320619.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.