Transcript: Mouse XM_017320654.1

PREDICTED: Mus musculus cut-like homeobox 1 (Cux1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cux1 (13047)
Length:
8403
CDS:
1468..6381

Additional Resources:

NCBI RefSeq record:
XM_017320654.1
NBCI Gene record:
Cux1 (13047)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017320654.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000310931 CAACCTCGGTCAGCGCTTATT pLKO_005 5244 CDS 100% 13.200 10.560 N Cux1 n/a
2 TRCN0000348944 AGGTTCTGGAATAACTCTTTA pLKO_005 6741 3UTR 100% 13.200 9.240 N Cux1 n/a
3 TRCN0000304350 CCAGCGCATCTTCGGACATTA pLKO_005 3537 CDS 100% 13.200 9.240 N Cux1 n/a
4 TRCN0000310929 GAAGTACCGAAACGAAGAAAT pLKO_005 3757 CDS 100% 13.200 9.240 N Cux1 n/a
5 TRCN0000070561 GCCCTCAGCATCCAAGAATTA pLKO.1 5155 CDS 100% 13.200 9.240 N Cux1 n/a
6 TRCN0000070562 CCTGGCTTCTACAGGAAAGTT pLKO.1 3240 CDS 100% 5.625 3.938 N Cux1 n/a
7 TRCN0000070559 GCAGCTCATCAAGCACAACAT pLKO.1 3513 CDS 100% 4.950 3.465 N Cux1 n/a
8 TRCN0000070558 GCCAAGAATAGCACACTCAAA pLKO.1 2824 CDS 100% 4.950 3.465 N Cux1 n/a
9 TRCN0000301670 GCCAAGAATAGCACACTCAAA pLKO_005 2824 CDS 100% 4.950 3.465 N Cux1 n/a
10 TRCN0000070560 CCACTGCTAAAGAGCTTCCAA pLKO.1 1918 CDS 100% 3.000 2.100 N Cux1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017320654.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.