Transcript: Mouse XM_017320733.1

PREDICTED: Mus musculus protein tyrosine phosphatase, non-receptor type 12 (Ptpn12), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ptpn12 (19248)
Length:
6791
CDS:
4033..6003

Additional Resources:

NCBI RefSeq record:
XM_017320733.1
NBCI Gene record:
Ptpn12 (19248)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017320733.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000271703 AGAAGTTAGAGCGCAATTTAA pLKO_005 4955 CDS 100% 15.000 21.000 N Ptpn12 n/a
2 TRCN0000271689 AGGATGATATGGGAGTATAAT pLKO_005 4030 5UTR 100% 15.000 21.000 N Ptpn12 n/a
3 TRCN0000271743 GTAGTTGACAGAACCTCTAAA pLKO_005 5083 CDS 100% 13.200 18.480 N Ptpn12 n/a
4 TRCN0000029879 GCAGTGTAGATTGTTACCTTA pLKO.1 6101 3UTR 100% 4.950 3.960 N Ptpn12 n/a
5 TRCN0000271699 TACAGGGCAAGTAGGTATATA pLKO_005 6336 3UTR 100% 15.000 10.500 N Ptpn12 n/a
6 TRCN0000281820 GTGGACGAACAGGTGCTATTT pLKO_005 4379 CDS 100% 13.200 9.240 N Ptpn12 n/a
7 TRCN0000029881 CCTATAACATTTGCACCATTT pLKO.1 4135 CDS 100% 10.800 7.560 N Ptpn12 n/a
8 TRCN0000029880 CCGAGTTAAGTTGACTTTGAA pLKO.1 3894 5UTR 100% 5.625 3.938 N Ptpn12 n/a
9 TRCN0000029882 GCCCTAAAGGTTGATGATGTA pLKO.1 5125 CDS 100% 4.950 3.465 N Ptpn12 n/a
10 TRCN0000029883 CCTTCGTCATTTGATTCTATT pLKO.1 4282 CDS 100% 13.200 7.920 N Ptpn12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017320733.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.