Transcript: Mouse XM_017320744.1

PREDICTED: Mus musculus phosphatidylinositol transfer protein, membrane-associated 2 (Pitpnm2), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pitpnm2 (19679)
Length:
6781
CDS:
201..4208

Additional Resources:

NCBI RefSeq record:
XM_017320744.1
NBCI Gene record:
Pitpnm2 (19679)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017320744.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100467 CGAAGGATGTCGCAGTCTATA pLKO.1 3790 CDS 100% 13.200 18.480 N Pitpnm2 n/a
2 TRCN0000348217 GACAGAAGCGGATTGACTATG pLKO_005 2908 CDS 100% 10.800 15.120 N Pitpnm2 n/a
3 TRCN0000348964 TGCGCCACAAGGCTAACTTTC pLKO_005 3715 CDS 100% 10.800 15.120 N Pitpnm2 n/a
4 TRCN0000100468 CAATACTATCACCAACGTGTT pLKO.1 1538 CDS 100% 4.050 5.670 N Pitpnm2 n/a
5 TRCN0000100465 GCCTTCTCTTTGATTTCTAAA pLKO.1 6526 3UTR 100% 13.200 9.240 N Pitpnm2 n/a
6 TRCN0000100466 CCCAGTGAGTATAAGACAGAA pLKO.1 648 CDS 100% 4.950 3.465 N Pitpnm2 n/a
7 TRCN0000302753 CCCAGTGAGTATAAGACAGAA pLKO_005 648 CDS 100% 4.950 3.465 N Pitpnm2 n/a
8 TRCN0000100469 GCTGAACATCATCGAGGATGA pLKO.1 1400 CDS 100% 4.050 2.835 N Pitpnm2 n/a
9 TRCN0000029764 GCTGTACATGATACAGAAGAA pLKO.1 263 CDS 100% 0.495 0.347 N PITPNM2 n/a
10 TRCN0000348216 ATGGCTGGCTCAGCACAATTT pLKO_005 3647 CDS 100% 13.200 7.920 N Pitpnm2 n/a
11 TRCN0000304933 GCCAATGACCGTGGATGAATA pLKO_005 230 CDS 100% 13.200 7.920 N Pitpnm2 n/a
12 TRCN0000304934 AGAAGTTCTCCATTGACATTG pLKO_005 514 CDS 100% 10.800 6.480 N Pitpnm2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017320744.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.