Transcript: Mouse XM_017320853.1

PREDICTED: Mus musculus cyclin G associated kinase (Gak), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gak (231580)
Length:
4225
CDS:
497..3784

Additional Resources:

NCBI RefSeq record:
XM_017320853.1
NBCI Gene record:
Gak (231580)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017320853.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000321678 ACGGTGGGTTTCTTGATATTC pLKO_005 1119 CDS 100% 13.200 18.480 N Gak n/a
2 TRCN0000321677 GAGTATGCATTAAAGCGATTA pLKO_005 211 5UTR 100% 10.800 15.120 N Gak n/a
3 TRCN0000027605 CTTCTCTAAGTCTGACAAGAA pLKO.1 3415 CDS 100% 4.950 6.930 N Gak n/a
4 TRCN0000027649 GCAGGAATATGACAGAATGAA pLKO.1 1843 CDS 100% 5.625 3.938 N Gak n/a
5 TRCN0000027663 CCAGAAATTGTAGACCTGTAT pLKO.1 698 CDS 100% 4.950 3.465 N Gak n/a
6 TRCN0000321738 CCAGAAATTGTAGACCTGTAT pLKO_005 698 CDS 100% 4.950 3.465 N Gak n/a
7 TRCN0000027669 CCTGATCTCTTTGGAGAGTTT pLKO.1 2795 CDS 100% 4.950 3.465 N Gak n/a
8 TRCN0000027643 GCAAAGGGTGATCTGGACATA pLKO.1 1217 CDS 100% 4.950 3.465 N Gak n/a
9 TRCN0000321676 GCAAAGGGTGATCTGGACATA pLKO_005 1217 CDS 100% 4.950 3.465 N Gak n/a
10 TRCN0000321679 TGGCCTGACTGAGGCACAAAT pLKO_005 3836 3UTR 100% 13.200 7.920 N Gak n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017320853.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.