Transcript: Mouse XM_017320855.1

PREDICTED: Mus musculus solute carrier family 26 (sulfate transporter), member 1 (Slc26a1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc26a1 (231583)
Length:
4119
CDS:
758..2872

Additional Resources:

NCBI RefSeq record:
XM_017320855.1
NBCI Gene record:
Slc26a1 (231583)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017320855.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000070290 CCATGTTAATGTGGGCATCTT pLKO.1 1114 CDS 100% 4.950 3.465 N Slc26a1 n/a
2 TRCN0000070288 CCCTTAATACATTCAAGGATT pLKO.1 3020 3UTR 100% 4.950 3.465 N Slc26a1 n/a
3 TRCN0000070292 GCAGCTAAGGAACTCTCAGAT pLKO.1 1598 CDS 100% 4.950 3.465 N Slc26a1 n/a
4 TRCN0000070289 GCTGGGTTACAACCCATCTAT pLKO.1 1037 CDS 100% 0.563 0.394 N Slc26a1 n/a
5 TRCN0000070291 GCCAACAAGGACTTCTTCCTT pLKO.1 2417 CDS 100% 0.300 0.180 N Slc26a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017320855.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.