Transcript: Mouse XM_017320866.1

PREDICTED: Mus musculus TRAF type zinc finger domain containing 1 (Trafd1), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Trafd1 (231712)
Length:
2529
CDS:
165..1895

Additional Resources:

NCBI RefSeq record:
XM_017320866.1
NBCI Gene record:
Trafd1 (231712)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017320866.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000182056 CACCTACTCGATGTCTCCTAA pLKO.1 1499 CDS 100% 4.950 6.930 N Trafd1 n/a
2 TRCN0000339509 CACCTACTCGATGTCTCCTAA pLKO_005 1499 CDS 100% 4.950 6.930 N Trafd1 n/a
3 TRCN0000197971 CCCAAATCTGACATGGACATT pLKO.1 303 CDS 100% 4.950 6.930 N Trafd1 n/a
4 TRCN0000181475 CGCACACTTGGACTTCATGTT pLKO.1 875 CDS 100% 4.950 6.930 N Trafd1 n/a
5 TRCN0000339508 CGCACACTTGGACTTCATGTT pLKO_005 875 CDS 100% 4.950 6.930 N Trafd1 n/a
6 TRCN0000339582 CTTGAGTGTGCAGCGTGTTAC pLKO_005 2281 3UTR 100% 10.800 8.640 N Trafd1 n/a
7 TRCN0000197997 CATGCCTTACGTTCACTCAAT pLKO.1 1110 CDS 100% 4.950 3.465 N Trafd1 n/a
8 TRCN0000339580 CATGCCTTACGTTCACTCAAT pLKO_005 1110 CDS 100% 4.950 3.465 N Trafd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017320866.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.