Transcript: Mouse XM_017320882.1

PREDICTED: Mus musculus leucine rich repeat and fibronectin type III, extracellular 1 (Elfn1), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Elfn1 (243312)
Length:
4918
CDS:
1436..3922

Additional Resources:

NCBI RefSeq record:
XM_017320882.1
NBCI Gene record:
Elfn1 (243312)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017320882.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000441769 ACACGCTGGAGCAGTACAATA pLKO_005 2463 CDS 100% 13.200 9.240 N Elfn1 n/a
2 TRCN0000416998 CCTGAGGCTGTGACTCGAATA pLKO_005 2903 CDS 100% 10.800 7.560 N Elfn1 n/a
3 TRCN0000109556 CCCAACATCGTCAACATAGAT pLKO.1 1901 CDS 100% 5.625 3.938 N Elfn1 n/a
4 TRCN0000109555 CCGAGACAGTAGATATACTAA pLKO.1 4130 3UTR 100% 5.625 3.938 N Elfn1 n/a
5 TRCN0000245756 AGTGTCCCAACATCGTCAACA pLKO_005 1896 CDS 100% 4.950 3.465 N ELFN1 n/a
6 TRCN0000109559 GACATCCTAGACTACTGGAAA pLKO.1 3875 CDS 100% 4.950 3.465 N Elfn1 n/a
7 TRCN0000109557 CCCTGTATACAAAGATGCCTT pLKO.1 3271 CDS 100% 2.640 1.848 N Elfn1 n/a
8 TRCN0000109558 CGGAAACCTCACATACCTCAA pLKO.1 1684 CDS 100% 4.050 2.430 N Elfn1 n/a
9 TRCN0000152087 CCAGATCATTAACAACTGCAT pLKO.1 3130 CDS 100% 2.640 1.584 N ELFN2 n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4200 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017320882.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.