Transcript: Mouse XM_017320944.1

PREDICTED: Mus musculus karyopherin alpha 7 (importin alpha 8) (Kpna7), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kpna7 (381686)
Length:
2156
CDS:
125..1624

Additional Resources:

NCBI RefSeq record:
XM_017320944.1
NBCI Gene record:
Kpna7 (381686)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017320944.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093345 CGGTGAATAGTTCAGATCCAA pLKO.1 351 CDS 100% 3.000 2.400 N Kpna7 n/a
2 TRCN0000093347 CCCTCCTCTCAATTTGATTAT pLKO.1 427 CDS 100% 13.200 9.240 N Kpna7 n/a
3 TRCN0000093346 CCTGGACATCATCGAGAAATA pLKO.1 1549 CDS 100% 13.200 9.240 N Kpna7 n/a
4 TRCN0000449295 GCCCAGGCTTGTAGAGCTTAT pLKO_005 973 CDS 100% 10.800 7.560 N Kpna7 n/a
5 TRCN0000093348 CGATACCTTGTCTCCACACTA pLKO.1 1017 CDS 100% 4.950 3.465 N Kpna7 n/a
6 TRCN0000093344 GCGTGGCTTCTGGCGATAGTA pLKO.1 1703 3UTR 100% 1.875 1.313 N Kpna7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017320944.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.