Transcript: Mouse XM_017320964.1

PREDICTED: Mus musculus mannoside acetylglucosaminyltransferase 4, isoenzyme A (Mgat4a), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mgat4a (269181)
Length:
7278
CDS:
1087..1959

Additional Resources:

NCBI RefSeq record:
XM_017320964.1
NBCI Gene record:
Mgat4a (269181)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017320964.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000018844 GCCTTTCGACTTTCCGTTATT pLKO.1 1879 CDS 100% 13.200 18.480 N Mgat4a n/a
2 TRCN0000018450 GCACTTCAACTTTCTTCGGAA pLKO.1 1180 CDS 100% 2.640 3.696 N Mgat4a n/a
3 TRCN0000018452 GCTGGTATTTGTCACGTCCTT pLKO.1 388 5UTR 100% 2.640 2.112 N Mgat4a n/a
4 TRCN0000372978 ACGATTAGAAGATGGCTATTT pLKO_005 1791 CDS 100% 13.200 9.240 N MGAT4A n/a
5 TRCN0000035813 GCCAACCTGGAGAAAGAATTT pLKO.1 919 5UTR 100% 13.200 9.240 N MGAT4A n/a
6 TRCN0000035811 GCCATTCTTAATGAGATTCAT pLKO.1 1918 CDS 100% 5.625 3.938 N MGAT4A n/a
7 TRCN0000018449 CCCTCTTAAGAGCGACAGTTT pLKO.1 1743 CDS 100% 4.950 3.465 N Mgat4a n/a
8 TRCN0000018451 CTGAGTACAATCTCAGATAAT pLKO.1 602 5UTR 100% 1.320 0.924 N Mgat4a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017320964.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.