Transcript: Mouse XM_017321037.1

PREDICTED: Mus musculus PAS domain containing serine/threonine kinase (Pask), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pask (269224)
Length:
4934
CDS:
135..4286

Additional Resources:

NCBI RefSeq record:
XM_017321037.1
NBCI Gene record:
Pask (269224)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321037.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000378461 GTGAGGGCGAGTACGACTATA pLKO_005 3286 CDS 100% 13.200 10.560 N Pask n/a
2 TRCN0000220688 CGAGCAGAACTGTCTAACATT pLKO.1 2787 CDS 100% 5.625 4.500 N Pask n/a
3 TRCN0000362872 GCTGCCAGATGGCACAATTTA pLKO_005 1181 CDS 100% 15.000 10.500 N Pask n/a
4 TRCN0000362804 AGCAGTGTGGACACGTGTAAT pLKO_005 2013 CDS 100% 13.200 9.240 N Pask n/a
5 TRCN0000220686 CCAGTCCTTAAAGAACATTTA pLKO.1 1710 CDS 100% 13.200 9.240 N Pask n/a
6 TRCN0000220689 CCTGAGGTTCTCATTGGAAAT pLKO.1 3825 CDS 100% 10.800 7.560 N Pask n/a
7 TRCN0000220685 GCGAGTTTCATCTTTCGACAA pLKO.1 3627 CDS 100% 4.050 2.835 N Pask n/a
8 TRCN0000220687 CCTGGGCAAGAATATCACTTT pLKO.1 1256 CDS 100% 4.950 2.970 N Pask n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321037.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.