Transcript: Mouse XM_017321093.1

PREDICTED: Mus musculus zinc finger protein 932 (Zfp932), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp932 (69504)
Length:
4052
CDS:
323..1804

Additional Resources:

NCBI RefSeq record:
XM_017321093.1
NBCI Gene record:
Zfp932 (69504)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321093.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000173991 GCCTATTCACGACACAGCATT pLKO.1 557 CDS 100% 4.950 3.465 N Zfp932 n/a
2 TRCN0000174737 GCCTCTCATAATAAACTTCAA pLKO.1 1319 CDS 100% 4.950 3.465 N Zfp932 n/a
3 TRCN0000194214 GCCTCTCATGATAAACTTCAA pLKO.1 1235 CDS 100% 4.950 3.465 N Zfp932 n/a
4 TRCN0000193872 CAGTAGTCTACAAATGCGTAA pLKO.1 487 CDS 100% 4.050 2.835 N Zfp932 n/a
5 TRCN0000217263 CTCTGAATCTGGACCCAATTA pLKO.1 2158 3UTR 100% 13.200 7.920 N Zfp932 n/a
6 TRCN0000176030 GCATACTAAAGAGTAACCCTA pLKO.1 1859 3UTR 100% 2.640 1.584 N Zfp932 n/a
7 TRCN0000096537 CTGGAGAGAAACCCTACAAAT pLKO.1 1695 CDS 100% 13.200 6.600 Y Zfp934 n/a
8 TRCN0000235358 CTGGAGAGAAACCCTACAAAT pLKO_005 1695 CDS 100% 13.200 6.600 Y 2810408B13Rik n/a
9 TRCN0000244342 CTGGAGAGAAACCCTACAAAT pLKO_005 1695 CDS 100% 13.200 6.600 Y EG668616 n/a
10 TRCN0000429043 ACCTTACAAATGTAATGAATG pLKO_005 1453 CDS 100% 10.800 5.400 Y Rex2 n/a
11 TRCN0000173219 CCTCTCATGGTCAACTTCAAA pLKO.1 1068 CDS 100% 5.625 2.813 Y Zfp932 n/a
12 TRCN0000016730 CTGGAGAGAAACCTTATGAAT pLKO.1 1275 CDS 100% 5.625 2.813 Y ZNF345 n/a
13 TRCN0000193310 CCTATGAATGTAATCAGTGTA pLKO.1 783 CDS 100% 4.950 2.475 Y Zfp932 n/a
14 TRCN0000158848 GAGAAACCTTACAAATGTGAT pLKO.1 692 CDS 100% 4.950 2.475 Y ZNF28 n/a
15 TRCN0000093238 GAGTCTCTACAAAGATGTGAT pLKO.1 304 5UTR 100% 4.950 2.475 Y Gm4983 n/a
16 TRCN0000120127 CCTGAGTTCAAATCCCAGCAA pLKO.1 2328 3UTR 100% 2.640 1.320 Y Adsl n/a
17 TRCN0000339691 CCTGAGTTCAAATCCCAGCAA pLKO_005 2328 3UTR 100% 2.640 1.320 Y Adsl n/a
18 TRCN0000174850 GCCTTTGCAAATCAAAGTTAT pLKO.1 1649 CDS 100% 1.320 0.660 Y Zfp932 n/a
19 TRCN0000240218 TAATCTACTTTCTGCTACTAG pLKO_005 169 5UTR 100% 4.950 6.930 N LOC666849 n/a
20 TRCN0000243782 TGGAGAGAAACCCTATGAATA pLKO_005 604 CDS 100% 13.200 6.600 Y Zfp977 n/a
21 TRCN0000095184 GCCTTGATGATAATAGACTAA pLKO.1 2135 3UTR 100% 4.950 2.475 Y Zfp459 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321093.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.