Transcript: Mouse XM_017321133.1

PREDICTED: Mus musculus E1A binding protein p400 (Ep400), transcript variant X9, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ep400 (75560)
Length:
11258
CDS:
431..9829

Additional Resources:

NCBI RefSeq record:
XM_017321133.1
NBCI Gene record:
Ep400 (75560)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321133.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305480 GTCGTCAGAAGGCCTTATATG pLKO_005 4305 CDS 100% 13.200 18.480 N Ep400 n/a
2 TRCN0000109315 CCGTGAACATTAGCTTTGATT pLKO.1 10186 3UTR 100% 5.625 7.875 N Ep400 n/a
3 TRCN0000109316 CGGAAGAATCTCAATGGCATA pLKO.1 3635 CDS 100% 4.050 5.670 N Ep400 n/a
4 TRCN0000109319 CCAGATTAAAGGGATTTGATA pLKO.1 3063 CDS 100% 5.625 4.500 N Ep400 n/a
5 TRCN0000109318 CCTCAAGTTGTGCAGCAACAA pLKO.1 9491 CDS 100% 4.950 3.960 N Ep400 n/a
6 TRCN0000351333 CCTCAAGTTGTGCAGCAACAA pLKO_005 9491 CDS 100% 4.950 3.960 N Ep400 n/a
7 TRCN0000305479 ATAGCTCAGCTGGCGTCTATT pLKO_005 5132 CDS 100% 13.200 9.240 N Ep400 n/a
8 TRCN0000311325 TGCTACTTTCCAGTCCATTAA pLKO_005 8332 CDS 100% 13.200 9.240 N Ep400 n/a
9 TRCN0000311323 TACTTGGTAGGACTCCATATC pLKO_005 10008 3UTR 100% 10.800 7.560 N Ep400 n/a
10 TRCN0000109317 GCTGACTTTATGGAACAGCTT pLKO.1 6767 CDS 100% 2.640 1.848 N Ep400 n/a
11 TRCN0000087583 AGGAGGAAGAGGAAGAGGAAA pLKO.1 1716 CDS 100% 4.950 2.475 Y Adam32 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321133.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.