Transcript: Mouse XM_017321182.1

PREDICTED: Mus musculus ankyrin repeat domain 17 (Ankrd17), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ankrd17 (81702)
Length:
4941
CDS:
526..4941

Additional Resources:

NCBI RefSeq record:
XM_017321182.1
NBCI Gene record:
Ankrd17 (81702)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321182.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304613 AGACCCTACTCACCGTTTAAA pLKO_005 2577 CDS 100% 15.000 21.000 N Ankrd17 n/a
2 TRCN0000072053 GCCCTTACATTAGCTTGTTAT pLKO.1 1723 CDS 100% 13.200 18.480 N Ankrd17 n/a
3 TRCN0000016951 GCTAGTATTGAGGACCATAAT pLKO.1 1585 CDS 100% 13.200 18.480 N ANKRD17 n/a
4 TRCN0000304666 GAATCGAACCACAGCTAATAA pLKO_005 2481 CDS 100% 15.000 10.500 N Ankrd17 n/a
5 TRCN0000072055 CCTCTCCAAATGGGAAGTTAA pLKO.1 4856 CDS 100% 13.200 9.240 N Ankrd17 n/a
6 TRCN0000072054 GCCGCAGATAAAGGGCATTAT pLKO.1 3739 CDS 100% 13.200 9.240 N Ankrd17 n/a
7 TRCN0000302187 GCCGCAGATAAAGGGCATTAT pLKO_005 3739 CDS 100% 13.200 9.240 N Ankrd17 n/a
8 TRCN0000285199 GGTCAATGATGAAGGTTATAC pLKO_005 1998 CDS 100% 13.200 9.240 N ANKRD17 n/a
9 TRCN0000016952 GCAGCAGATAACCGCAAGATA pLKO.1 3901 CDS 100% 5.625 3.938 N ANKRD17 n/a
10 TRCN0000274424 GCAGCAGATAACCGCAAGATA pLKO_005 3901 CDS 100% 5.625 3.938 N ANKRD17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321182.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.