Transcript: Mouse XM_017321290.1

PREDICTED: Mus musculus synaptotagmin XIV (Syt14), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Syt14 (329324)
Length:
13512
CDS:
269..1879

Additional Resources:

NCBI RefSeq record:
XM_017321290.1
NBCI Gene record:
Syt14 (329324)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321290.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093198 ACCTTGTTCTTCTACCTATAA pLKO.1 1056 CDS 100% 13.200 18.480 N Syt14 n/a
2 TRCN0000093197 CGGAAACTGCATTCAGAGAAT pLKO.1 595 CDS 100% 4.950 6.930 N Syt14 n/a
3 TRCN0000093194 CCACGTTGAATCCGAGATGAT pLKO.1 1147 CDS 100% 4.950 3.960 N Syt14 n/a
4 TRCN0000382178 AGATGAAGCACTGGGTAAATA pLKO_005 430 CDS 100% 15.000 10.500 N Syt14 n/a
5 TRCN0000002109 CCTTGTTCTTCTACCTATAAA pLKO.1 1057 CDS 100% 15.000 10.500 N SYT14 n/a
6 TRCN0000380727 ATCTTGGTTCAGGATACAATA pLKO_005 333 CDS 100% 13.200 9.240 N Syt14 n/a
7 TRCN0000002108 CCTTATCCAGAACACACAATT pLKO.1 459 CDS 100% 13.200 9.240 N SYT14 n/a
8 TRCN0000093195 GCAGTTAGGTTTAGACTATAT pLKO.1 1178 CDS 100% 13.200 9.240 N Syt14 n/a
9 TRCN0000380843 GGCCGAGAGCTATCACAATAA pLKO_005 796 CDS 100% 13.200 9.240 N Syt14 n/a
10 TRCN0000093196 GTCACAGACATTCCAACATAT pLKO.1 1004 CDS 100% 13.200 9.240 N Syt14 n/a
11 TRCN0000314848 CTTGTTCTTCTACCTATAAAG pLKO_005 1058 CDS 100% 13.200 9.240 N SYT14 n/a
12 TRCN0000147941 GAGATGTCCAAATGCAAGATA pLKO.1 1607 CDS 100% 5.625 3.938 N SYT14P1 n/a
13 TRCN0000147682 GACTATCAGCAGAAGTGATAA pLKO.1 1446 CDS 100% 1.320 0.924 N SYT14P1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321290.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.