Transcript: Mouse XM_017321386.1

PREDICTED: Mus musculus RIKEN cDNA A530032D15Rik gene (A530032D15Rik), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
A530032D15Rik (381287)
Length:
1233
CDS:
169..846

Additional Resources:

NCBI RefSeq record:
XM_017321386.1
NBCI Gene record:
A530032D15Rik (381287)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321386.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000443255 TATAGTGGAAAGCACAAATCC pLKO_005 1128 3UTR 100% 4.950 6.930 N A530032D15Rik n/a
2 TRCN0000453073 GTGTCTTTGCAATTCTTATTT pLKO_005 1096 3UTR 100% 15.000 10.500 N A530032D15Rik n/a
3 TRCN0000452868 CACCCTTCTATTTGAACATAT pLKO_005 1056 3UTR 100% 13.200 9.240 N A530032D15Rik n/a
4 TRCN0000448220 GTGTGCTGTGACGGGATTTGA pLKO_005 968 3UTR 100% 5.625 3.938 N A530032D15Rik n/a
5 TRCN0000183491 GTTTCCTGAATAGTGGGATTA pLKO.1 878 3UTR 100% 10.800 5.400 Y A530032D15Rik n/a
6 TRCN0000178800 CAGAATGAAGAGGAGTCAGAT pLKO.1 259 CDS 100% 4.950 2.475 Y A530032D15Rik n/a
7 TRCN0000184720 CCACAATGCAATGGAGGAGTT pLKO.1 622 CDS 100% 4.050 2.025 Y A530032D15Rik n/a
8 TRCN0000184557 GCTTGCCTCTTGTTTCCTGAA pLKO.1 867 3UTR 100% 4.050 2.025 Y A530032D15Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321386.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.