Transcript: Mouse XM_017321502.1

PREDICTED: Mus musculus collagen, type XXVIII, alpha 1 (Col28a1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Col28a1 (213945)
Length:
5185
CDS:
378..3803

Additional Resources:

NCBI RefSeq record:
XM_017321502.1
NBCI Gene record:
Col28a1 (213945)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321502.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000091574 GCTATGGATCACAAGGAATTA pLKO.1 2491 CDS 100% 13.200 18.480 N Col28a1 n/a
2 TRCN0000091576 CCTTCCAATGAACCCGTTCTA pLKO.1 993 CDS 100% 4.950 6.930 N Col28a1 n/a
3 TRCN0000091573 GCGGGTCAAGTCTCTGAATTT pLKO.1 734 CDS 100% 13.200 9.240 N Col28a1 n/a
4 TRCN0000091577 GCAGCTAATGACATGTTCAAA pLKO.1 3024 CDS 100% 5.625 3.938 N Col28a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321502.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.