Transcript: Mouse XM_017321610.1

PREDICTED: Mus musculus solute carrier organic anion transporter family, member 1a4 (Slco1a4), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slco1a4 (28250)
Length:
1700
CDS:
289..1566

Additional Resources:

NCBI RefSeq record:
XM_017321610.1
NBCI Gene record:
Slco1a4 (28250)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321610.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079887 CACGTCTGTAGTTGGGCTTAT pLKO.1 450 CDS 100% 10.800 15.120 N Slco1a4 n/a
2 TRCN0000425606 AGGCATTTCTGTTGGCATTAA pLKO_005 347 CDS 100% 13.200 9.240 N Slco1a4 n/a
3 TRCN0000413307 AGGTCAATGCCTTTATCAATT pLKO_005 1271 CDS 100% 13.200 9.240 N Slco1a4 n/a
4 TRCN0000079884 GCAATCCGATTTACATGATTT pLKO.1 1229 CDS 100% 13.200 9.240 N Slco1a4 n/a
5 TRCN0000079885 CCTCAAATAGCTTTGTGTGTA pLKO.1 665 CDS 100% 4.950 3.465 N Slco1a4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321610.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.