Transcript: Mouse XM_017321614.1

PREDICTED: Mus musculus ninjurin 2 (Ninj2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ninj2 (29862)
Length:
1159
CDS:
236..622

Additional Resources:

NCBI RefSeq record:
XM_017321614.1
NBCI Gene record:
Ninj2 (29862)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321614.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428603 TAGAGAACCAGAGGCATTTAA pLKO_005 477 CDS 100% 15.000 10.500 N Ninj2 n/a
2 TRCN0000438425 GACCTCCAGCAATCCTATTTG pLKO_005 601 CDS 100% 13.200 9.240 N Ninj2 n/a
3 TRCN0000437207 CTTCAAGGGCTACGAAGAAAC pLKO_005 719 3UTR 100% 10.800 7.560 N Ninj2 n/a
4 TRCN0000108454 GCCACCATCTTGGTCTTCATA pLKO.1 515 CDS 100% 5.625 3.938 N Ninj2 n/a
5 TRCN0000108451 GCTCTTTATGTCCAATGCCAT pLKO.1 316 CDS 100% 2.640 1.848 N Ninj2 n/a
6 TRCN0000108452 CCTTCTTGTGTTCATCGCCAT pLKO.1 439 CDS 100% 2.160 1.512 N Ninj2 n/a
7 TRCN0000108450 CCTGACTTGTCAGGATAACTA pLKO.1 673 3UTR 100% 0.563 0.394 N Ninj2 n/a
8 TRCN0000063775 CTGAACCTGAATGAGGTAGAA pLKO.1 461 CDS 100% 4.950 3.465 N NINJ2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321614.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.