Transcript: Mouse XM_017321714.1

PREDICTED: Mus musculus coiled-coil domain containing 91 (Ccdc91), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ccdc91 (67015)
Length:
2621
CDS:
365..1693

Additional Resources:

NCBI RefSeq record:
XM_017321714.1
NBCI Gene record:
Ccdc91 (67015)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321714.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000126334 CGGATCTAACTCTCTGCTATT pLKO.1 1965 3UTR 100% 10.800 15.120 N Ccdc91 n/a
2 TRCN0000287962 CGGATCTAACTCTCTGCTATT pLKO_005 1965 3UTR 100% 10.800 15.120 N Ccdc91 n/a
3 TRCN0000295251 TATCAAGTCTGGAGACTAAAC pLKO_005 780 CDS 100% 10.800 15.120 N Ccdc91 n/a
4 TRCN0000126335 GCGCTGAGCATTATAGTGGAT pLKO.1 992 CDS 100% 2.640 2.112 N Ccdc91 n/a
5 TRCN0000287964 GCGCTGAGCATTATAGTGGAT pLKO_005 992 CDS 100% 2.640 2.112 N Ccdc91 n/a
6 TRCN0000295252 GAAAGTTCATGCCGAAGAAAG pLKO_005 1357 CDS 100% 10.800 7.560 N Ccdc91 n/a
7 TRCN0000126338 ACATCTGAACATCCCTCTCTT pLKO.1 655 CDS 100% 4.950 3.465 N Ccdc91 n/a
8 TRCN0000126336 CAATGAAAGATGTCATCACTA pLKO.1 1305 CDS 100% 4.950 3.465 N Ccdc91 n/a
9 TRCN0000126337 GAAGCAATATGTGTCTGCAAT pLKO.1 1066 CDS 100% 4.950 3.465 N Ccdc91 n/a
10 TRCN0000287963 GAAGCAATATGTGTCTGCAAT pLKO_005 1066 CDS 100% 4.950 3.465 N Ccdc91 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321714.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.