Transcript: Mouse XM_017321842.1

PREDICTED: Mus musculus BCL2-like 13 (apoptosis facilitator) (Bcl2l13), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Bcl2l13 (94044)
Length:
6838
CDS:
191..1387

Additional Resources:

NCBI RefSeq record:
XM_017321842.1
NBCI Gene record:
Bcl2l13 (94044)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321842.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241893 ACGCCGCAGAGTTCATCATTC pLKO_005 639 CDS 100% 10.800 15.120 N Bcl2l13 n/a
2 TRCN0000241896 ATATGAGGCATATCGTGAATG pLKO_005 469 CDS 100% 10.800 15.120 N Bcl2l13 n/a
3 TRCN0000245403 GTCACACCTCGCCTGTGTTTA pLKO_005 327 CDS 100% 13.200 10.560 N Bcl2l13 n/a
4 TRCN0000241895 CCCTTTGCGGCACGGAATAAT pLKO_005 5870 3UTR 100% 15.000 10.500 N Bcl2l13 n/a
5 TRCN0000215579 GAAGATAGCAATGACATTTAT pLKO.1 728 CDS 100% 15.000 10.500 N Bcl2l13 n/a
6 TRCN0000241894 GAAGATAGCAATGACATTTAT pLKO_005 728 CDS 100% 15.000 10.500 N Bcl2l13 n/a
7 TRCN0000174671 GCAAAGAGATTATCCCAAGTT pLKO.1 2147 3UTR 100% 4.950 3.465 N Bcl2l13 n/a
8 TRCN0000193470 GCTCCATCTTTCAAAGATGAT pLKO.1 2052 3UTR 100% 0.495 0.347 N Bcl2l13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321842.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.