Transcript: Mouse XM_017321868.1

PREDICTED: Mus musculus syntaxin 6 (Stx6), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Stx6 (58244)
Length:
2530
CDS:
252..716

Additional Resources:

NCBI RefSeq record:
XM_017321868.1
NBCI Gene record:
Stx6 (58244)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321868.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379491 GGCCGTCATGCTAGATGATTT pLKO_005 539 CDS 100% 13.200 18.480 N Stx6 n/a
2 TRCN0000115076 GCTGGGTAAGAGTTGAGATTA pLKO.1 1264 3UTR 100% 13.200 9.240 N Stx6 n/a
3 TRCN0000339680 GCTGGGTAAGAGTTGAGATTA pLKO_005 1264 3UTR 100% 13.200 9.240 N Stx6 n/a
4 TRCN0000115078 CGTGATGAAGAAACTTGCAAA pLKO.1 599 CDS 100% 4.950 3.465 N Stx6 n/a
5 TRCN0000339605 CGTGATGAAGAAACTTGCAAA pLKO_005 599 CDS 100% 4.950 3.465 N Stx6 n/a
6 TRCN0000380713 GTGCCATAGCCATCCTCTTTG pLKO_005 655 CDS 100% 10.800 7.560 N STX6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321868.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02362 pDONR223 100% 53.7% 56% None (many diffs) n/a
2 ccsbBroad304_02362 pLX_304 0% 53.7% 56% V5 (many diffs) n/a
Download CSV