Transcript: Mouse XM_017321978.1

PREDICTED: Mus musculus gamma-aminobutyric acid (GABA) A receptor, subunit gamma 3 (Gabrg3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gabrg3 (14407)
Length:
9799
CDS:
445..1851

Additional Resources:

NCBI RefSeq record:
XM_017321978.1
NBCI Gene record:
Gabrg3 (14407)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321978.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000088959 CCTGGTCTATTGGGTTGGATA pLKO.1 1818 CDS 100% 4.950 6.930 N Gabrg3 n/a
2 TRCN0000088960 GCCTTCAAGCACCCTCTAATT pLKO.1 1553 CDS 100% 13.200 10.560 N Gabrg3 n/a
3 TRCN0000063055 CCTTCGATTCAACAGCACAAT pLKO.1 762 CDS 100% 4.950 3.465 N GABRG3 n/a
4 TRCN0000088958 CTGAGGGATGACTGAAGAGTA pLKO.1 1860 3UTR 100% 4.950 3.465 N Gabrg3 n/a
5 TRCN0000088961 GCGGCTCTATCAGTTTGACTT pLKO.1 1092 CDS 100% 4.950 3.465 N Gabrg3 n/a
6 TRCN0000088962 CAAGATGGATTCCTGATCGAA pLKO.1 1529 CDS 100% 3.000 2.100 N Gabrg3 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2064 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321978.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.