Transcript: Mouse XM_017322054.1

PREDICTED: Mus musculus ryanodine receptor 1, skeletal muscle (Ryr1), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ryr1 (20190)
Length:
15400
CDS:
154..15282

Additional Resources:

NCBI RefSeq record:
XM_017322054.1
NBCI Gene record:
Ryr1 (20190)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017322054.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000453156 GCCGCATGTCATCGAGATTAC pLKO_005 9975 CDS 100% 10.800 15.120 N Ryr1 n/a
2 TRCN0000103014 CGACAGGAGTTAGTCAACTTT pLKO.1 6259 CDS 100% 5.625 7.875 N Ryr1 n/a
3 TRCN0000103013 GCTGCCTAAGACGTATATGAT pLKO.1 3039 CDS 100% 5.625 7.875 N Ryr1 n/a
4 TRCN0000103010 GCGGAATTACAACTTGCAGAT pLKO.1 2928 CDS 100% 4.050 5.670 N Ryr1 n/a
5 TRCN0000359102 CAACACCACCACGTACTATTA pLKO_005 4461 CDS 100% 13.200 10.560 N RYR1 n/a
6 TRCN0000103012 CCTCCGAATCATTGTGAACAA pLKO.1 10134 CDS 100% 4.950 3.960 N Ryr1 n/a
7 TRCN0000069748 CGGCGATGAATATGAACTTTA pLKO.1 14883 CDS 100% 13.200 9.240 N LOC381861 n/a
8 TRCN0000447817 GACATCCCTGCACGCAGAAAT pLKO_005 3211 CDS 100% 13.200 9.240 N Ryr1 n/a
9 TRCN0000069751 GCCGTAGTGGTCTACTTGTAT pLKO.1 14701 CDS 100% 5.625 3.938 N LOC381861 n/a
10 TRCN0000069752 GCAGTGACTACTTCGACACAA pLKO.1 15059 CDS 100% 4.950 3.465 N LOC381861 n/a
11 TRCN0000069750 GCTATCATTCAGGGTCTGATT pLKO.1 14956 CDS 100% 4.950 3.465 N LOC381861 n/a
12 TRCN0000069749 GCCTTCAACTTCTTCCGCAAA pLKO.1 14731 CDS 100% 4.050 2.835 N LOC381861 n/a
13 TRCN0000103011 CGTCGCATAGAACGGATCTAT pLKO.1 12745 CDS 100% 0.563 0.394 N Ryr1 n/a
14 TRCN0000436479 CAAGGATGTCATCGAGGAATA pLKO_005 12000 CDS 100% 10.800 5.400 Y Rps12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017322054.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.