Transcript: Mouse XM_017322076.1

PREDICTED: Mus musculus RIKEN cDNA 9830147E19 gene (9830147E19Rik), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp976 (208111)
Length:
5967
CDS:
2210..3721

Additional Resources:

NCBI RefSeq record:
XM_017322076.1
NBCI Gene record:
Zfp976 (208111)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017322076.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243779 CAAATGTCTCAGTCATCTTCA pLKO_005 2656 CDS 100% 4.950 3.465 N Zfp977 n/a
2 TRCN0000243778 GAATATGCACAATGGGATAAA pLKO_005 2630 CDS 100% 13.200 7.920 N Zfp977 n/a
3 TRCN0000243780 GAAATGGAAGGCATGAAAGAA pLKO_005 2586 CDS 100% 5.625 3.375 N Zfp977 n/a
4 TRCN0000243781 TGGGATAAATCCTTCAAATGT pLKO_005 2642 CDS 100% 5.625 3.375 N Zfp977 n/a
5 TRCN0000218590 ACAGGTGAGAAACCCTATAAA pLKO_005 3536 CDS 100% 15.000 7.500 Y Zfp936 n/a
6 TRCN0000234230 ACTGGAGAGAAGCCCTATAAA pLKO_005 3452 CDS 100% 15.000 7.500 Y EG666702 n/a
7 TRCN0000243782 TGGAGAGAAACCCTATGAATA pLKO_005 2614 CDS 100% 13.200 6.600 Y Zfp977 n/a
8 TRCN0000016730 CTGGAGAGAAACCTTATGAAT pLKO.1 3789 3UTR 100% 5.625 2.813 Y ZNF345 n/a
9 TRCN0000158848 GAGAAACCTTACAAATGTGAT pLKO.1 3290 CDS 100% 4.950 2.475 Y ZNF28 n/a
10 TRCN0000148848 CATACAGGTGAGAAACCCTAT pLKO.1 3533 CDS 100% 4.050 2.025 Y ZNF260 n/a
11 TRCN0000235273 ACTGGAGAGAAACCTTATAAA pLKO_005 3200 CDS 100% 15.000 7.500 Y Gm10771 n/a
12 TRCN0000337271 ACTGGAGAGAAACCTTATAAA pLKO_005 3200 CDS 100% 15.000 7.500 Y ZNF286B n/a
13 TRCN0000219092 ACTGCTATAGGCTACAATTTG pLKO_005 2525 CDS 100% 13.200 6.600 Y EG666702 n/a
14 TRCN0000234294 GTAAGGCCTTTACACAAAGAG pLKO_005 3654 CDS 100% 4.950 2.475 Y ENSMUSG00000067075 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017322076.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.