Transcript: Mouse XM_017322141.1

PREDICTED: Mus musculus zinc finger protein 93 (Zfp93), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp93 (22755)
Length:
5952
CDS:
3281..5332

Additional Resources:

NCBI RefSeq record:
XM_017322141.1
NBCI Gene record:
Zfp93 (22755)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017322141.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255555 GACCTTAAATCGGCCATATTT pLKO_005 5334 3UTR 100% 15.000 10.500 N Zfp93 n/a
2 TRCN0000085027 TCACCCAGCATTGTGTTTATA pLKO.1 4047 CDS 100% 15.000 10.500 N Zfp93 n/a
3 TRCN0000085026 AGTAGTGACAATCAGGAATTT pLKO.1 3800 CDS 100% 13.200 9.240 N Zfp93 n/a
4 TRCN0000255556 CTTGGAGTAAGGCACACTTTA pLKO_005 3843 CDS 100% 13.200 9.240 N Zfp93 n/a
5 TRCN0000265671 CCTCTTGACACAACAGGAATA pLKO_005 3563 CDS 100% 10.800 7.560 N Zfp93 n/a
6 TRCN0000265657 TTAACATTCTGGGTTGCATTT pLKO_005 3939 CDS 100% 10.800 7.560 N Zfp93 n/a
7 TRCN0000085023 CCCATATTGTAAAGAGAACAT pLKO.1 5837 3UTR 100% 4.950 3.465 N Zfp93 n/a
8 TRCN0000085025 CTGGAGAATCTCCCAAGCAAT pLKO.1 3770 CDS 100% 4.950 3.465 N Zfp93 n/a
9 TRCN0000239756 ACAGGAGAGAAGCCATATAAG pLKO_005 4484 CDS 100% 13.200 6.600 Y Gm11677 n/a
10 TRCN0000239754 GAGAAACCTTATGAGTGTAAT pLKO_005 4574 CDS 100% 13.200 6.600 Y Gm11677 n/a
11 TRCN0000265667 CTGGAGCTTGAGCCTTCATAG pLKO_005 4867 CDS 100% 10.800 5.400 Y Zfp93 n/a
12 TRCN0000239755 GTGGGAAGCGCTTCAGCTTAA pLKO_005 4599 CDS 100% 10.800 5.400 Y Gm11677 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017322141.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.