Transcript: Mouse XM_017322210.1

PREDICTED: Mus musculus proline rich 14 (Prr14), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Prr14 (233895)
Length:
8018
CDS:
6250..7911

Additional Resources:

NCBI RefSeq record:
XM_017322210.1
NBCI Gene record:
Prr14 (233895)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017322210.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000201023 CAGTAGAATTTCGGGACAGTA pLKO.1 7715 CDS 100% 4.950 6.930 N Prr14 n/a
2 TRCN0000350149 CAGTAGAATTTCGGGACAGTA pLKO_005 7715 CDS 100% 4.950 6.930 N Prr14 n/a
3 TRCN0000192106 CCATTCCAACTGTCTACTCTA pLKO.1 6775 CDS 100% 4.950 3.465 N Prr14 n/a
4 TRCN0000320115 CCATTCCAACTGTCTACTCTA pLKO_005 6775 CDS 100% 4.950 3.465 N Prr14 n/a
5 TRCN0000190549 GAGCGCAATGGAACTCTGATT pLKO.1 7666 CDS 100% 4.950 3.465 N Prr14 n/a
6 TRCN0000320177 GAGCGCAATGGAACTCTGATT pLKO_005 7666 CDS 100% 4.950 3.465 N Prr14 n/a
7 TRCN0000192432 CCAACTCTTACTTTGTCCCTT pLKO.1 6688 CDS 100% 2.640 1.848 N Prr14 n/a
8 TRCN0000320185 CCAACTCTTACTTTGTCCCTT pLKO_005 6688 CDS 100% 2.640 1.848 N Prr14 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1051 5UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017322210.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.