Transcript: Mouse XM_017322278.1

PREDICTED: Mus musculus family with sequence similarity 135, member A (Fam135a), transcript variant X11, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fam135a (68187)
Length:
4353
CDS:
298..3543

Additional Resources:

NCBI RefSeq record:
XM_017322278.1
NBCI Gene record:
Fam135a (68187)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017322278.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264934 GTAAGTAGTGACACGATTAAA pLKO_005 1264 CDS 100% 15.000 21.000 N Fam135a n/a
2 TRCN0000345671 TAAGTAGTGACACGATTAAAT pLKO_005 1265 CDS 100% 15.000 21.000 N Fam135a n/a
3 TRCN0000345746 ACTTTGAGGGTTCGCAGATTT pLKO_005 198 5UTR 100% 13.200 18.480 N Fam135a n/a
4 TRCN0000264932 CGATCCTTATTCAGACTATAT pLKO_005 3843 3UTR 100% 13.200 10.560 N Fam135a n/a
5 TRCN0000190316 CGGAACACAATCTGGCATCTA pLKO.1 911 CDS 100% 4.950 3.960 N Fam135a n/a
6 TRCN0000283238 GACATTCGTTAGGCAATTTAA pLKO_005 2969 CDS 100% 15.000 10.500 N Fam135a n/a
7 TRCN0000345745 GATCCTTATTCAGACTATATC pLKO_005 3844 3UTR 100% 13.200 9.240 N Fam135a n/a
8 TRCN0000216603 GATGCTAAGTTTATGACATAT pLKO.1 3617 3UTR 100% 13.200 9.240 N Fam135a n/a
9 TRCN0000136155 GCCCGCATTGAAATGTGTAAA pLKO.1 3292 CDS 100% 13.200 9.240 N FAM135A n/a
10 TRCN0000200857 GCCTAAATCTTTGTGCAAATT pLKO.1 836 CDS 100% 13.200 9.240 N Fam135a n/a
11 TRCN0000201523 CCTCATTTGGATGCTCCCTTT pLKO.1 1846 CDS 100% 4.050 2.835 N Fam135a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017322278.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.