Transcript: Mouse XM_017322283.1

PREDICTED: Mus musculus monoacylglycerol O-acyltransferase 1 (Mogat1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mogat1 (68393)
Length:
1098
CDS:
187..1089

Additional Resources:

NCBI RefSeq record:
XM_017322283.1
NBCI Gene record:
Mogat1 (68393)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017322283.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248173 TGGATCCGGGTCACAATTATA pLKO_005 479 CDS 100% 15.000 21.000 N Mogat1 n/a
2 TRCN0000248170 TTTCCCGTTGTTCCGAGAATA pLKO_005 630 CDS 100% 13.200 18.480 N Mogat1 n/a
3 TRCN0000193954 GCCAGTTTGGTTCCAGTATTT pLKO.1 841 CDS 100% 13.200 10.560 N Mogat1 n/a
4 TRCN0000248172 CAGGTGTGCATTGGAATTATG pLKO_005 283 CDS 100% 13.200 9.240 N Mogat1 n/a
5 TRCN0000248174 TTTCACCCTCATGGAATATTC pLKO_005 508 CDS 100% 13.200 9.240 N Mogat1 n/a
6 TRCN0000174487 CTCAGACTTCAAGAAGCTATT pLKO.1 564 CDS 100% 10.800 7.560 N Mogat1 n/a
7 TRCN0000217902 GACGCAATGTATGATTCAATG pLKO.1 931 CDS 100% 10.800 7.560 N Mogat1 n/a
8 TRCN0000248171 CAGACTTCAAGAAGCTATTTC pLKO_005 566 CDS 100% 13.200 7.920 N Mogat1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017322283.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.