Transcript: Mouse XM_017322321.1

PREDICTED: Mus musculus NLR family, pyrin domain containing 12 (Nlrp12), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nlrp12 (378425)
Length:
5060
CDS:
954..3701

Additional Resources:

NCBI RefSeq record:
XM_017322321.1
NBCI Gene record:
Nlrp12 (378425)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017322321.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216414 GTAGATTCCACGCAGATAATT pLKO.1 3942 3UTR 100% 15.000 12.000 N Nlrp12 n/a
2 TRCN0000363040 CACTCGGCTTCTCCTAGTAAA pLKO_005 1007 CDS 100% 13.200 9.240 N Nlrp12 n/a
3 TRCN0000203720 CAGACCCTGCATGAGCTTTAT pLKO.1 3507 CDS 100% 13.200 9.240 N Nlrp12 n/a
4 TRCN0000363039 GACAAGCAAGCCGGGTGTTAA pLKO_005 1681 CDS 100% 13.200 9.240 N Nlrp12 n/a
5 TRCN0000216380 GGTATAAGGCACCTTACAAAT pLKO.1 4329 3UTR 100% 13.200 9.240 N Nlrp12 n/a
6 TRCN0000362971 TATTCCAGAAGGGTATCAAAT pLKO_005 2032 CDS 100% 13.200 9.240 N Nlrp12 n/a
7 TRCN0000363042 TCATTGATGGCTTCGATAAAC pLKO_005 1411 CDS 100% 13.200 9.240 N Nlrp12 n/a
8 TRCN0000187316 CCAAAGCATGTGAGGACCTTT pLKO.1 3466 CDS 100% 4.950 3.465 N Nlrp12 n/a
9 TRCN0000185592 CAACAACTCATATCTGGTAGA pLKO.1 2987 CDS 100% 4.050 2.835 N Nlrp12 n/a
10 TRCN0000203343 CCTTTCTTCTATCCTGGGAAT pLKO.1 3482 CDS 100% 4.050 2.835 N Nlrp12 n/a
11 TRCN0000203969 GATTGCAAACTCCAGACCCTT pLKO.1 3249 CDS 100% 2.640 1.848 N Nlrp12 n/a
12 TRCN0000185521 GCATGAGCTTTATTTGACCAA pLKO.1 3515 CDS 100% 2.640 1.848 N Nlrp12 n/a
13 TRCN0000186757 GAATTTAATCAGGCTGGACCT pLKO.1 2825 CDS 100% 2.160 1.512 N Nlrp12 n/a
14 TRCN0000363043 TAAAGACCCACAAGGTAATTT pLKO_005 4086 3UTR 100% 15.000 9.000 N Nlrp12 n/a
15 TRCN0000182716 CCTGAGTTCAATTCCCAGCAA pLKO.1 4150 3UTR 100% 2.640 1.320 Y BC028528 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017322321.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.