Transcript: Mouse XM_017322380.1

PREDICTED: Mus musculus secretory blood group 1 (Sec1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sec1 (56546)
Length:
2891
CDS:
956..2125

Additional Resources:

NCBI RefSeq record:
XM_017322380.1
NBCI Gene record:
Sec1 (56546)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017322380.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110391 CCAAGGACATTGCATTGCTCA pLKO.1 1854 CDS 100% 2.640 2.112 N Sec1 n/a
2 TRCN0000110392 CGTGGTCACCAGTGATGACAT pLKO.1 1756 CDS 100% 4.950 3.465 N Sec1 n/a
3 TRCN0000110393 CAAGGACATTGCATTGCTCAT pLKO.1 1855 CDS 100% 4.050 2.835 N Sec1 n/a
4 TRCN0000110394 CTTCTACCTCTTCTTCGTGAT pLKO.1 1093 CDS 100% 4.050 2.835 N Sec1 n/a
5 TRCN0000110390 GCCCGGATGAATGGACGGCTT pLKO.1 1295 CDS 100% 0.000 0.000 N Sec1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017322380.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.