Transcript: Human XM_024446014.1

PREDICTED: Homo sapiens SLIT-ROBO Rho GTPase activating protein 2 (SRGAP2), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SRGAP2 (23380)
Length:
6305
CDS:
128..3289

Additional Resources:

NCBI RefSeq record:
XM_024446014.1
NBCI Gene record:
SRGAP2 (23380)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446014.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000352352 GGGTCATGTAGCCGATATTTA pLKO_005 2503 CDS 100% 15.000 21.000 N SRGAP2 n/a
2 TRCN0000047959 GCATGGAGGATTACTGTGATA pLKO.1 2118 CDS 100% 4.950 3.465 N SRGAP2 n/a
3 TRCN0000047958 GCCTGTCAAGTCTGTCAAGAT pLKO.1 3142 CDS 100% 4.950 3.465 N SRGAP2 n/a
4 TRCN0000047960 CGACCATGACATGGATTCCAT pLKO.1 1696 CDS 100% 3.000 2.100 N SRGAP2 n/a
5 TRCN0000047962 CTGAGGTCATTGCTCAGGATA pLKO.1 2889 CDS 100% 0.495 0.347 N SRGAP2 n/a
6 TRCN0000370872 CATGACCTATCTGACCTTATT pLKO_005 842 CDS 100% 13.200 6.600 Y SRGAP2 n/a
7 TRCN0000370810 ATAATATCATTCCTCGATTTG pLKO_005 399 CDS 100% 10.800 5.400 Y SRGAP2 n/a
8 TRCN0000352377 GCAAATTGGTAAATCGGTAAA pLKO_005 604 CDS 100% 10.800 5.400 Y SRGAP2 n/a
9 TRCN0000281902 CATCTGTCTTCAAGTACTATA pLKO_005 819 CDS 100% 13.200 6.600 Y Srgap2 n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3771 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446014.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.