Transcript: Human XM_024446137.1

PREDICTED: Homo sapiens CCR4-NOT transcription complex subunit 6 (CNOT6), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CNOT6 (57472)
Length:
5746
CDS:
833..1981

Additional Resources:

NCBI RefSeq record:
XM_024446137.1
NBCI Gene record:
CNOT6 (57472)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446137.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050614 CCAGGATATATTGAACCTTTA pLKO.1 706 5UTR 100% 10.800 15.120 N CNOT6 n/a
2 TRCN0000299414 CCAGGATATATTGAACCTTTA pLKO_005 706 5UTR 100% 10.800 15.120 N CNOT6 n/a
3 TRCN0000050617 CAAGGGTATAATAGACTACAT pLKO.1 1765 CDS 100% 4.950 6.930 N CNOT6 n/a
4 TRCN0000299490 CAAGGGTATAATAGACTACAT pLKO_005 1765 CDS 100% 4.950 6.930 N CNOT6 n/a
5 TRCN0000050616 GCGCATCTTTGTGGTCACTAA pLKO.1 524 5UTR 100% 4.950 6.930 N CNOT6 n/a
6 TRCN0000331657 GCGCATCTTTGTGGTCACTAA pLKO_005 524 5UTR 100% 4.950 6.930 N CNOT6 n/a
7 TRCN0000050613 GCTTTGCATTTGAGTGACAAT pLKO.1 556 5UTR 100% 4.950 3.960 N CNOT6 n/a
8 TRCN0000299491 GCTTTGCATTTGAGTGACAAT pLKO_005 556 5UTR 100% 4.950 3.960 N CNOT6 n/a
9 TRCN0000050615 GCAACCTCAAATCCAGTGTTT pLKO.1 1482 CDS 100% 4.950 3.465 N CNOT6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446137.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.