Transcript: Human XM_024446247.1

PREDICTED: Homo sapiens 5-phosphohydroxy-L-lysine phospho-lyase (PHYKPL), transcript variant X26, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PHYKPL (85007)
Length:
1738
CDS:
590..1375

Additional Resources:

NCBI RefSeq record:
XM_024446247.1
NBCI Gene record:
PHYKPL (85007)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446247.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000151359 GTTGAGTACTTCAACACGTTT pLKO.1 932 CDS 100% 0.495 0.693 N PHYKPL n/a
2 TRCN0000151788 CTAAGTGTACTCCAGAAGAAA pLKO.1 1392 3UTR 100% 5.625 3.938 N PHYKPL n/a
3 TRCN0000155023 GCCATTCTGACTGACATGGAA pLKO.1 1313 CDS 100% 3.000 2.100 N PHYKPL n/a
4 TRCN0000155771 CCTGAATGTCTTGGAGAAGGA pLKO.1 991 CDS 100% 2.640 1.848 N PHYKPL n/a
5 TRCN0000150658 GAGGAACATCCTGAAGTTTAA pLKO.1 1237 CDS 100% 13.200 7.920 N PHYKPL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446247.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04466 pDONR223 100% 54.6% 47.5% None (many diffs) n/a
2 ccsbBroad304_04466 pLX_304 0% 54.6% 47.5% V5 (many diffs) n/a
Download CSV