Transcript: Human XM_024446386.1

PREDICTED: Homo sapiens sirtuin 5 (SIRT5), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SIRT5 (23408)
Length:
3399
CDS:
225..1157

Additional Resources:

NCBI RefSeq record:
XM_024446386.1
NBCI Gene record:
SIRT5 (23408)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446386.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232660 GAGATCCATGGTAGCTTATTT pLKO_005 690 CDS 100% 15.000 21.000 N SIRT5 n/a
2 TRCN0000257335 GCGTGCCAGTGGCTGAATTTA pLKO_005 1027 CDS 100% 15.000 21.000 N SIRT5 n/a
3 TRCN0000018546 CGTCCACACGAAACCAGATTT pLKO.1 292 CDS 100% 13.200 18.480 N SIRT5 n/a
4 TRCN0000018545 GCTACGAACAGATTCAGGTTT pLKO.1 1065 CDS 100% 4.950 6.930 N SIRT5 n/a
5 TRCN0000018543 CCAGCTATATTGTGGCCTGAA pLKO.1 263 CDS 100% 4.050 5.670 N SIRT5 n/a
6 TRCN0000018547 GAGCTGGTGTTAGTGCAGAAA pLKO.1 397 CDS 100% 4.950 3.960 N SIRT5 n/a
7 TRCN0000232659 GATTGATTTCCCAGCTATATT pLKO_005 253 CDS 100% 15.000 10.500 N SIRT5 n/a
8 TRCN0000232661 AGAATTACAAGAGTCCAATTT pLKO_005 745 CDS 100% 13.200 9.240 N SIRT5 n/a
9 TRCN0000232662 CTGAGTACTGAACAATCTAAA pLKO_005 1239 3UTR 100% 13.200 9.240 N SIRT5 n/a
10 TRCN0000018544 GAGTCCAATTTGTCCAGCTTT pLKO.1 755 CDS 100% 4.950 3.465 N SIRT5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446386.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07880 pDONR223 98.4% 99.8% 100% None 657C>T n/a
2 ccsbBroad304_07880 pLX_304 0% 99.8% 100% V5 (not translated due to prior stop codon) 657C>T n/a
Download CSV