Transcript: Human XM_024447007.1

PREDICTED: Homo sapiens secernin 1 (SCRN1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SCRN1 (9805)
Length:
5495
CDS:
554..1798

Additional Resources:

NCBI RefSeq record:
XM_024447007.1
NBCI Gene record:
SCRN1 (9805)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447007.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000151868 CAGACTATGATGAACACCTTA pLKO.1 1307 CDS 100% 4.950 3.960 N SCRN1 n/a
2 TRCN0000292361 CAGACTATGATGAACACCTTA pLKO_005 1307 CDS 100% 4.950 3.960 N SCRN1 n/a
3 TRCN0000154742 GCTTTCGCTCACCACTAAGAT pLKO.1 1123 CDS 100% 5.625 3.938 N SCRN1 n/a
4 TRCN0000292306 GCTTTCGCTCACCACTAAGAT pLKO_005 1123 CDS 100% 5.625 3.938 N SCRN1 n/a
5 TRCN0000156205 CCACAGCTTCCAAAGTGCATA pLKO.1 1003 CDS 100% 4.950 3.465 N SCRN1 n/a
6 TRCN0000292362 CCACAGCTTCCAAAGTGCATA pLKO_005 1003 CDS 100% 4.950 3.465 N SCRN1 n/a
7 TRCN0000151411 GCCTACTATGAAATGTCTCAT pLKO.1 3836 3UTR 100% 4.950 3.465 N SCRN1 n/a
8 TRCN0000344041 GCCTACTATGAAATGTCTCAT pLKO_005 3836 3UTR 100% 4.950 3.465 N SCRN1 n/a
9 TRCN0000151544 GAAACAGCTAAAGAAGCCTTA pLKO.1 914 CDS 100% 4.050 2.835 N SCRN1 n/a
10 TRCN0000152277 CCTATGCCATAATGATAAGCA pLKO.1 747 CDS 100% 3.000 2.100 N SCRN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447007.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07490 pDONR223 100% 99.9% 99.7% None 893C>A n/a
2 ccsbBroad304_07490 pLX_304 0% 99.9% 99.7% V5 893C>A n/a
Download CSV