Transcript: Human XM_024447516.1

PREDICTED: Homo sapiens olfactory receptor family 1 subfamily J member 2 (OR1J2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
OR1J2 (26740)
Length:
1854
CDS:
913..1854

Additional Resources:

NCBI RefSeq record:
XM_024447516.1
NBCI Gene record:
OR1J2 (26740)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447516.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000203612 CCGACTGTAAGCAGTTCTATT pLKO.1 1696 CDS 100% 13.200 18.480 N OR1J2 n/a
2 TRCN0000187764 GCGGACTAAGTACAAATCGAT pLKO.1 1167 CDS 100% 3.000 4.200 N OR1J2 n/a
3 TRCN0000186697 GTCTCTCTATTATGGGTCAAT pLKO.1 1656 CDS 100% 4.950 3.960 N OR1J2 n/a
4 TRCN0000185844 GAATGCATTTCTCAGATGTAT pLKO.1 1198 CDS 100% 5.625 3.938 N OR1J2 n/a
5 TRCN0000203850 CCTGGTATCATATGGCTACAT pLKO.1 1554 CDS 100% 0.000 0.000 N OR1J2 n/a
6 TRCN0000204867 GTACTTCTTCCTCAGCCACTT pLKO.1 1089 CDS 100% 4.050 2.025 Y Olfr339 n/a
7 TRCN0000060371 CCATGTACTTCTTCCTCAGAA pLKO.1 1085 CDS 100% 4.950 2.475 Y OR10A2 n/a
8 TRCN0000188492 CCCATGTACTTCTTCCTCACA pLKO.1 1084 CDS 100% 2.640 1.320 Y Olfr317 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447516.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.