Transcript: Human XM_024447966.1

PREDICTED: Homo sapiens APOBEC1 complementation factor (A1CF), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
A1CF (29974)
Length:
9088
CDS:
240..1772

Additional Resources:

NCBI RefSeq record:
XM_024447966.1
NBCI Gene record:
A1CF (29974)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447966.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294215 AGGATGAGCTTATACCATTAT pLKO_005 193 5UTR 100% 13.200 18.480 N A1CF n/a
2 TRCN0000061846 GAATGCAATCAAGCAACTTAA pLKO.1 317 CDS 100% 13.200 18.480 N A1CF n/a
3 TRCN0000286827 GAATGCAATCAAGCAACTTAA pLKO_005 317 CDS 100% 13.200 18.480 N A1CF n/a
4 TRCN0000294155 TGTGGACAACTGCCGATTATT pLKO_005 383 CDS 100% 15.000 12.000 N A1CF n/a
5 TRCN0000267468 ACAAGACTTAGCAGCATATAC pLKO_005 1688 CDS 100% 13.200 10.560 N A1cf n/a
6 TRCN0000294280 ACAAGACTTAGCAGCATATAC pLKO_005 1688 CDS 100% 13.200 10.560 N A1CF n/a
7 TRCN0000061845 CCATGCTGCAAGGAGAGTATA pLKO.1 949 CDS 100% 13.200 9.240 N A1CF n/a
8 TRCN0000286753 CCATGCTGCAAGGAGAGTATA pLKO_005 949 CDS 100% 13.200 9.240 N A1CF n/a
9 TRCN0000061843 CCCAGATATTAGAAGAGATTT pLKO.1 1330 CDS 100% 13.200 9.240 N A1CF n/a
10 TRCN0000061844 GCTACTGCTTTCCCAGGATAT pLKO.1 1605 CDS 100% 10.800 7.560 N A1CF n/a
11 TRCN0000061847 GCAACAATAGAGGATATGCAT pLKO.1 265 CDS 100% 3.000 2.100 N A1CF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447966.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.