Transcript: Human XM_024447997.1

PREDICTED: Homo sapiens coiled-coil and C2 domain containing 2B (CC2D2B), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CC2D2B (387707)
Length:
8475
CDS:
426..4715

Additional Resources:

NCBI RefSeq record:
XM_024447997.1
NBCI Gene record:
CC2D2B (387707)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447997.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000172504 CGACCTAAACACCCAACACAT pLKO.1 4386 CDS 100% 4.950 6.930 N CC2D2B n/a
2 TRCN0000272463 AGACCAGTAAACCGTAGTTAT pLKO_005 738 CDS 100% 13.200 10.560 N CC2D2B n/a
3 TRCN0000167694 GACGGAGATATTAAGATTCTT pLKO.1 2970 CDS 100% 5.625 4.500 N CC2D2B n/a
4 TRCN0000422465 CACAATTCTAATGCAACATTT pLKO_005 3807 CDS 100% 13.200 9.240 N CC2D2B n/a
5 TRCN0000272409 CAGCTCATTGATAGCGAAATA pLKO_005 606 CDS 100% 13.200 9.240 N CC2D2B n/a
6 TRCN0000167663 GTATCCGTTTCAGATGTAAAT pLKO.1 2715 CDS 100% 13.200 9.240 N CC2D2B n/a
7 TRCN0000413281 TATTATCTGTGTGGGTCTATT pLKO_005 4669 CDS 100% 13.200 9.240 N CC2D2B n/a
8 TRCN0000417379 TTGATGTACAGTCAATTATTG pLKO_005 4558 CDS 100% 13.200 9.240 N CC2D2B n/a
9 TRCN0000272464 TGAAGTCTCATTGGATGAAAG pLKO_005 656 CDS 100% 10.800 7.560 N CC2D2B n/a
10 TRCN0000167753 GCAGTTTGTAAGTTTGTTGAA pLKO.1 2886 CDS 100% 4.950 3.465 N CC2D2B n/a
11 TRCN0000167730 GAAATTGTATCTACAAGCCAA pLKO.1 2856 CDS 100% 2.640 1.848 N CC2D2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447997.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.