Transcript: Human XM_024448002.1

PREDICTED: Homo sapiens coiled-coil and C2 domain containing 2B (CC2D2B), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CC2D2B (387707)
Length:
4122
CDS:
114..4025

Additional Resources:

NCBI RefSeq record:
XM_024448002.1
NBCI Gene record:
CC2D2B (387707)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448002.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000172504 CGACCTAAACACCCAACACAT pLKO.1 4039 3UTR 100% 4.950 6.930 N CC2D2B n/a
2 TRCN0000272463 AGACCAGTAAACCGTAGTTAT pLKO_005 450 CDS 100% 13.200 10.560 N CC2D2B n/a
3 TRCN0000167694 GACGGAGATATTAAGATTCTT pLKO.1 2682 CDS 100% 5.625 4.500 N CC2D2B n/a
4 TRCN0000422465 CACAATTCTAATGCAACATTT pLKO_005 3519 CDS 100% 13.200 9.240 N CC2D2B n/a
5 TRCN0000272409 CAGCTCATTGATAGCGAAATA pLKO_005 318 CDS 100% 13.200 9.240 N CC2D2B n/a
6 TRCN0000167663 GTATCCGTTTCAGATGTAAAT pLKO.1 2427 CDS 100% 13.200 9.240 N CC2D2B n/a
7 TRCN0000272464 TGAAGTCTCATTGGATGAAAG pLKO_005 368 CDS 100% 10.800 7.560 N CC2D2B n/a
8 TRCN0000167753 GCAGTTTGTAAGTTTGTTGAA pLKO.1 2598 CDS 100% 4.950 3.465 N CC2D2B n/a
9 TRCN0000167730 GAAATTGTATCTACAAGCCAA pLKO.1 2568 CDS 100% 2.640 1.848 N CC2D2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448002.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.