Transcript: Human XM_024448054.1

PREDICTED: Homo sapiens armadillo repeat containing 4 (ARMC4), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARMC4 (55130)
Length:
3602
CDS:
143..3256

Additional Resources:

NCBI RefSeq record:
XM_024448054.1
NBCI Gene record:
ARMC4 (55130)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448054.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229773 AGTAAGAGTCATACGAATAAA pLKO_005 1787 CDS 100% 15.000 21.000 N ARMC4 n/a
2 TRCN0000135118 CGGGAATACAAAGCCATTGAA pLKO.1 2189 CDS 100% 5.625 7.875 N ARMC4 n/a
3 TRCN0000134415 GTTGTTAGCAAACCCTTTCAA pLKO.1 3343 3UTR 100% 5.625 7.875 N ARMC4 n/a
4 TRCN0000229774 CCTTGGCCAGTCTACTCAATA pLKO_005 2085 CDS 100% 13.200 10.560 N ARMC4 n/a
5 TRCN0000229775 CATGGCCAGAAAGCCTAAATT pLKO_005 3314 3UTR 100% 15.000 10.500 N ARMC4 n/a
6 TRCN0000218804 GAACCTCCTTGTTGGAATAAA pLKO_005 2341 CDS 100% 15.000 10.500 N ARMC4 n/a
7 TRCN0000229772 TGCAGTGCAGGAGGAGTATTT pLKO_005 932 CDS 100% 13.200 9.240 N ARMC4 n/a
8 TRCN0000135860 CAAGTGTATGTGCTGCCATTA pLKO.1 2757 CDS 100% 10.800 7.560 N ARMC4 n/a
9 TRCN0000135117 CACTGACAATAAAGAGCGGTT pLKO.1 2107 CDS 100% 2.160 1.512 N ARMC4 n/a
10 TRCN0000135266 CCTCAGCATTTGAATCAGGTT pLKO.1 336 CDS 100% 2.640 1.584 N ARMC4 n/a
11 TRCN0000136341 GCAAATTCAGAAGCTGGTGAA pLKO.1 1498 CDS 100% 4.050 2.025 Y ARMC4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448054.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08473 pDONR223 100% 87.9% 87.9% None (many diffs) n/a
Download CSV